Search                    Advanced Search               Customer Service (800) 786-5777 Sign In     My Cart    My Account    Corporate    Distributors    Customer Service    order@4adi.com Thursday June 22, 2017 Custom peptides & Antibodies Published references using ADI custom services Custom Services Order forms Free Selection of Antigenic Peptides Custom peptide synthesis Custom Peptide conjugation to KLH BSA etc Pre activated KLH BSA to prepare peptide protein Custom Antibodies of Proteins Custom Peptide Synthesis & Antibodies Primary Antibodies List of primary antibodies by product categories Alphabetical list of Antibodies 0-9 Alphabetical list of Antibodies A-C Alphabetical list of Antibodies D-G Alphabetical list of Antibodies H-M Alphabetical list of Antibodies N-Q Alphabetical list of Antibodies R-Z Fusion Tag Antibodies categories Control IgGs (non-immune) (Beta-actin, GAPDH) antibodies New Primary Antibodies 2-Antibodies & ELISA Reagents Antibody-HRP labeling & biotinylation kits Antigen-Antibody Pens Biotin, Streptavdin Conjuagtes and Coated Plates Bulk Secondary Antibodies & Antisera (Anti-IgG, IgM, IgA, IgG1-4 etc) Custom labeling of proteins and antibodies ELISA Kits for the detection of Abs ELISA/Western Accessories Normal Pre-immune (control) Serum Pre-activated agarose to couple peptides and proteins Protein A & G Proteins and Coated Plates Secondary antibodies and Conjugates Western blot recycling kit ELISA Kits, TruStrips and Rapid Tests TruStrips and Rapid Tests Elisa Kits for Human Proteins Elisa Kits for Mouse Proteins Elisa Kits for Other Animals (Rat, Monkey, Goat etc) Autoimmune ELISA kits (Anti-dsDNA, ANA etc) Anti-Ovalbumin and anti-DNP ELISA kits for Mouse and Rat ELISA kits for Host Cell Proteins Contaminants ELISA kits for the Detection of Various Animals antibodies ELISA Kits for Infectious Diseases (Hepatitis, etc) Elisa Kits for Animal Health Screening Human and Disease Sera and Plasma ELISA Readers & Instruments New Elisa kits & Products Vaccines Therapeutics & Food Safety Kits Horse/Pig/Beef Meat Adulteration ELISAs Human Therapeutic Mabs ELISA Kits and Reagents for Vaccine Research ELISA Kits for Food Safety/Environment Vaccine Adjuvants & ODNs Vaccine Identification kits Protein Lysates, Blots & Tissue Slides/Arrays Protein Blots-Multiple regions, tissues & species Custom protein blots Tissue and Cell lysate for Western Tissue Slides for Immunohistochemistry Tissues/Cells (Slides & Arrays) for IHC Peptides, Proteins, Enzymes & cDNAs Aptamers and DNA/RNA libraries Bioactive Peptides Full length cDNAs (human & Animals) Pharmaceutical peptides & intermediates Purified Proteins (Natural) Purified Proteins (Recombinant) Purified Allergens (Recombinant) Purified Cancer antigens Purified Enzymes (Research & Diagnostic)

Search Browse By New Products Special Promotions Request A Catalog Request Quote Catalog Peptides, Proteins, Enzymes & cDNAs Recently Viewed Items Join Mailing Lists          Home Page >Online Product Catalog > Peptides, Proteins, Enzymes & cDNAs > Adenosine, DNA Aptamer, unlabeled (DNA Aptamers) Adenosine, DNA Aptamer, unlabeled Catalog# Product Description Product Type Antibody Type Size Price AD-103-U Adenosine, DNA Aptamer, unlabeled DNA Aptamers Custom Contact Sales Product Overview Data Sheets & MSDS Related Items General Information Citations Antigen 5'-ACTCATCTGTGAGACTCACTATAGGAAGAGATGTCAACTCGTGCACGAGTTGACATCTCTTCTCCGAGCCGGTCGAAATATTGGAGGAAGCTCGAGCTGGAGGAAAAGTGAGTCTCACAGATGAGT-3'; 126-mer For research use only, not for diagnostic or therapeutic use. Data Sheets AD-103.pdf MSDS Related Items General Information Citations Search ADI Product Citation Data Base Search

Alpha Diagnostic Intl. Inc.| 6203 Woodlake Center | San Antonio, Texas 78244 USA
Toll Free: (800)-786-5777 | 210-561-9515 | Fax: 210-561-9544 | Web: www.4adi.com
Copyright ©1996 - 2017.  All rights reserved.

Return Policy |  Terms & Conditions |  Privacy Statement

Alpha Diagnostic Intl. Inc. ISO 13485 Certified